ID: 1171021013

View in Genome Browser
Species Human (GRCh38)
Location 20:21584034-21584056
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171021013_1171021014 11 Left 1171021013 20:21584034-21584056 CCGATTGCACGGACGGCTTATAG No data
Right 1171021014 20:21584068-21584090 GTGCATCGATATGCTAATGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171021013 Original CRISPR CTATAAGCCGTCCGTGCAAT CGG (reversed) Intergenic
No off target data available for this crispr