ID: 1171022047

View in Genome Browser
Species Human (GRCh38)
Location 20:21594093-21594115
Sequence TGATGTGCCCAGCATATTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171022047_1171022049 15 Left 1171022047 20:21594093-21594115 CCTCCAATATGCTGGGCACATCA No data
Right 1171022049 20:21594131-21594153 ATCTGCATAACAAATTTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171022047 Original CRISPR TGATGTGCCCAGCATATTGG AGG (reversed) Intergenic
No off target data available for this crispr