ID: 1171022879

View in Genome Browser
Species Human (GRCh38)
Location 20:21602698-21602720
Sequence CTGTGGGTAGGGAGGGCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171022869_1171022879 12 Left 1171022869 20:21602663-21602685 CCTGAGGCTTCCTGGGGCTTGGG No data
Right 1171022879 20:21602698-21602720 CTGTGGGTAGGGAGGGCTGGAGG No data
1171022871_1171022879 2 Left 1171022871 20:21602673-21602695 CCTGGGGCTTGGGAAGAAAGCTC No data
Right 1171022879 20:21602698-21602720 CTGTGGGTAGGGAGGGCTGGAGG No data
1171022867_1171022879 15 Left 1171022867 20:21602660-21602682 CCACCTGAGGCTTCCTGGGGCTT No data
Right 1171022879 20:21602698-21602720 CTGTGGGTAGGGAGGGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171022879 Original CRISPR CTGTGGGTAGGGAGGGCTGG AGG Intergenic
No off target data available for this crispr