ID: 1171023708

View in Genome Browser
Species Human (GRCh38)
Location 20:21609751-21609773
Sequence TGCCATGACCACAGTGGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171023701_1171023708 18 Left 1171023701 20:21609710-21609732 CCATCAATTCATTCTTCTTTGAA No data
Right 1171023708 20:21609751-21609773 TGCCATGACCACAGTGGGTTGGG No data
1171023700_1171023708 19 Left 1171023700 20:21609709-21609731 CCCATCAATTCATTCTTCTTTGA No data
Right 1171023708 20:21609751-21609773 TGCCATGACCACAGTGGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171023708 Original CRISPR TGCCATGACCACAGTGGGTT GGG Intergenic
No off target data available for this crispr