ID: 1171027233

View in Genome Browser
Species Human (GRCh38)
Location 20:21641646-21641668
Sequence TTTATTCGACAACAGGAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171027233_1171027237 28 Left 1171027233 20:21641646-21641668 CCACATTCCTGTTGTCGAATAAA No data
Right 1171027237 20:21641697-21641719 ACTCAAGTCTTTATTAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171027233 Original CRISPR TTTATTCGACAACAGGAATG TGG (reversed) Intergenic
No off target data available for this crispr