ID: 1171030076

View in Genome Browser
Species Human (GRCh38)
Location 20:21669185-21669207
Sequence CAGGAGAAGCAGAGAAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171030076_1171030081 2 Left 1171030076 20:21669185-21669207 CCCTCCTTTCTCTGCTTCTCCTG No data
Right 1171030081 20:21669210-21669232 CTACTAGGTCTTCTTCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171030076 Original CRISPR CAGGAGAAGCAGAGAAAGGA GGG (reversed) Intergenic
No off target data available for this crispr