ID: 1171032089

View in Genome Browser
Species Human (GRCh38)
Location 20:21685981-21686003
Sequence CTGTAACTCATTAATAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171032089_1171032092 -5 Left 1171032089 20:21685981-21686003 CCTTCATTATTAATGAGTTACAG No data
Right 1171032092 20:21685999-21686021 TACAGTTGACACCCTGGCTTGGG No data
1171032089_1171032096 26 Left 1171032089 20:21685981-21686003 CCTTCATTATTAATGAGTTACAG No data
Right 1171032096 20:21686030-21686052 TCTCAGTGTGTGCTCCCATCTGG No data
1171032089_1171032097 27 Left 1171032089 20:21685981-21686003 CCTTCATTATTAATGAGTTACAG No data
Right 1171032097 20:21686031-21686053 CTCAGTGTGTGCTCCCATCTGGG No data
1171032089_1171032091 -6 Left 1171032089 20:21685981-21686003 CCTTCATTATTAATGAGTTACAG No data
Right 1171032091 20:21685998-21686020 TTACAGTTGACACCCTGGCTTGG No data
1171032089_1171032098 28 Left 1171032089 20:21685981-21686003 CCTTCATTATTAATGAGTTACAG No data
Right 1171032098 20:21686032-21686054 TCAGTGTGTGCTCCCATCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171032089 Original CRISPR CTGTAACTCATTAATAATGA AGG (reversed) Intergenic
No off target data available for this crispr