ID: 1171032092

View in Genome Browser
Species Human (GRCh38)
Location 20:21685999-21686021
Sequence TACAGTTGACACCCTGGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171032085_1171032092 30 Left 1171032085 20:21685946-21685968 CCAGTGACTGCTGCAGAAAGGGA No data
Right 1171032092 20:21685999-21686021 TACAGTTGACACCCTGGCTTGGG No data
1171032089_1171032092 -5 Left 1171032089 20:21685981-21686003 CCTTCATTATTAATGAGTTACAG No data
Right 1171032092 20:21685999-21686021 TACAGTTGACACCCTGGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171032092 Original CRISPR TACAGTTGACACCCTGGCTT GGG Intergenic
No off target data available for this crispr