ID: 1171032096

View in Genome Browser
Species Human (GRCh38)
Location 20:21686030-21686052
Sequence TCTCAGTGTGTGCTCCCATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171032093_1171032096 -3 Left 1171032093 20:21686010-21686032 CCCTGGCTTGGGCAGCCATTTCT No data
Right 1171032096 20:21686030-21686052 TCTCAGTGTGTGCTCCCATCTGG No data
1171032089_1171032096 26 Left 1171032089 20:21685981-21686003 CCTTCATTATTAATGAGTTACAG No data
Right 1171032096 20:21686030-21686052 TCTCAGTGTGTGCTCCCATCTGG No data
1171032094_1171032096 -4 Left 1171032094 20:21686011-21686033 CCTGGCTTGGGCAGCCATTTCTC No data
Right 1171032096 20:21686030-21686052 TCTCAGTGTGTGCTCCCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171032096 Original CRISPR TCTCAGTGTGTGCTCCCATC TGG Intergenic
No off target data available for this crispr