ID: 1171032924

View in Genome Browser
Species Human (GRCh38)
Location 20:21693105-21693127
Sequence GAGGGGAGAGGCCCAAGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171032924_1171032936 26 Left 1171032924 20:21693105-21693127 CCAGGACTTGGGCCTCTCCCCTC No data
Right 1171032936 20:21693154-21693176 CCGCACTTTAACCTGCCTTTTGG No data
1171032924_1171032937 27 Left 1171032924 20:21693105-21693127 CCAGGACTTGGGCCTCTCCCCTC No data
Right 1171032937 20:21693155-21693177 CGCACTTTAACCTGCCTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171032924 Original CRISPR GAGGGGAGAGGCCCAAGTCC TGG (reversed) Intergenic