ID: 1171034016

View in Genome Browser
Species Human (GRCh38)
Location 20:21702392-21702414
Sequence CTGGAGTCCTTGAAATGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171034010_1171034016 17 Left 1171034010 20:21702352-21702374 CCCAAGTTGGACTTAAATCAGCT No data
Right 1171034016 20:21702392-21702414 CTGGAGTCCTTGAAATGCATGGG No data
1171034009_1171034016 25 Left 1171034009 20:21702344-21702366 CCTGTATGCCCAAGTTGGACTTA No data
Right 1171034016 20:21702392-21702414 CTGGAGTCCTTGAAATGCATGGG No data
1171034011_1171034016 16 Left 1171034011 20:21702353-21702375 CCAAGTTGGACTTAAATCAGCTT No data
Right 1171034016 20:21702392-21702414 CTGGAGTCCTTGAAATGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171034016 Original CRISPR CTGGAGTCCTTGAAATGCAT GGG Intergenic
No off target data available for this crispr