ID: 1171037703

View in Genome Browser
Species Human (GRCh38)
Location 20:21729219-21729241
Sequence TGCAGCTAAGGCCACCCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171037694_1171037703 18 Left 1171037694 20:21729178-21729200 CCCGGAAGTAGGCCAGGTTGAGC No data
Right 1171037703 20:21729219-21729241 TGCAGCTAAGGCCACCCCTCAGG No data
1171037700_1171037703 6 Left 1171037700 20:21729190-21729212 CCAGGTTGAGCATGGTTTGGGGG No data
Right 1171037703 20:21729219-21729241 TGCAGCTAAGGCCACCCCTCAGG No data
1171037695_1171037703 17 Left 1171037695 20:21729179-21729201 CCGGAAGTAGGCCAGGTTGAGCA No data
Right 1171037703 20:21729219-21729241 TGCAGCTAAGGCCACCCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171037703 Original CRISPR TGCAGCTAAGGCCACCCCTC AGG Intergenic
No off target data available for this crispr