ID: 1171042278

View in Genome Browser
Species Human (GRCh38)
Location 20:21776557-21776579
Sequence GTGTGGGTCTGGAAGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171042273_1171042278 1 Left 1171042273 20:21776533-21776555 CCTGCGTAGCTCTAGTCTTTTGC No data
Right 1171042278 20:21776557-21776579 GTGTGGGTCTGGAAGGCAGAAGG No data
1171042272_1171042278 2 Left 1171042272 20:21776532-21776554 CCCTGCGTAGCTCTAGTCTTTTG No data
Right 1171042278 20:21776557-21776579 GTGTGGGTCTGGAAGGCAGAAGG No data
1171042270_1171042278 6 Left 1171042270 20:21776528-21776550 CCTCCCCTGCGTAGCTCTAGTCT No data
Right 1171042278 20:21776557-21776579 GTGTGGGTCTGGAAGGCAGAAGG No data
1171042268_1171042278 15 Left 1171042268 20:21776519-21776541 CCAGAGCTCCCTCCCCTGCGTAG No data
Right 1171042278 20:21776557-21776579 GTGTGGGTCTGGAAGGCAGAAGG No data
1171042269_1171042278 7 Left 1171042269 20:21776527-21776549 CCCTCCCCTGCGTAGCTCTAGTC No data
Right 1171042278 20:21776557-21776579 GTGTGGGTCTGGAAGGCAGAAGG No data
1171042267_1171042278 16 Left 1171042267 20:21776518-21776540 CCCAGAGCTCCCTCCCCTGCGTA No data
Right 1171042278 20:21776557-21776579 GTGTGGGTCTGGAAGGCAGAAGG No data
1171042271_1171042278 3 Left 1171042271 20:21776531-21776553 CCCCTGCGTAGCTCTAGTCTTTT No data
Right 1171042278 20:21776557-21776579 GTGTGGGTCTGGAAGGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171042278 Original CRISPR GTGTGGGTCTGGAAGGCAGA AGG Intergenic
No off target data available for this crispr