ID: 1171049183 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:21839738-21839760 |
| Sequence | CTGAACTTTCTATGGAGGGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1171049183_1171049190 | 0 | Left | 1171049183 | 20:21839738-21839760 | CCCTCCCTCCATAGAAAGTTCAG | No data | ||
| Right | 1171049190 | 20:21839761-21839783 | GAACCGGCAACACTAATCTATGG | No data | ||||
| 1171049183_1171049194 | 30 | Left | 1171049183 | 20:21839738-21839760 | CCCTCCCTCCATAGAAAGTTCAG | No data | ||
| Right | 1171049194 | 20:21839791-21839813 | CCTCAAAATGTGGTTATTTCTGG | No data | ||||
| 1171049183_1171049192 | 20 | Left | 1171049183 | 20:21839738-21839760 | CCCTCCCTCCATAGAAAGTTCAG | No data | ||
| Right | 1171049192 | 20:21839781-21839803 | TGGTGATAGACCTCAAAATGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1171049183 | Original CRISPR | CTGAACTTTCTATGGAGGGA GGG (reversed) | Intergenic | ||