ID: 1171049186

View in Genome Browser
Species Human (GRCh38)
Location 20:21839742-21839764
Sequence GTTCCTGAACTTTCTATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171049186_1171049196 30 Left 1171049186 20:21839742-21839764 CCCTCCATAGAAAGTTCAGGAAC No data
Right 1171049196 20:21839795-21839817 AAAATGTGGTTATTTCTGGGTGG No data
1171049186_1171049192 16 Left 1171049186 20:21839742-21839764 CCCTCCATAGAAAGTTCAGGAAC No data
Right 1171049192 20:21839781-21839803 TGGTGATAGACCTCAAAATGTGG No data
1171049186_1171049195 27 Left 1171049186 20:21839742-21839764 CCCTCCATAGAAAGTTCAGGAAC No data
Right 1171049195 20:21839792-21839814 CTCAAAATGTGGTTATTTCTGGG No data
1171049186_1171049190 -4 Left 1171049186 20:21839742-21839764 CCCTCCATAGAAAGTTCAGGAAC No data
Right 1171049190 20:21839761-21839783 GAACCGGCAACACTAATCTATGG No data
1171049186_1171049194 26 Left 1171049186 20:21839742-21839764 CCCTCCATAGAAAGTTCAGGAAC No data
Right 1171049194 20:21839791-21839813 CCTCAAAATGTGGTTATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171049186 Original CRISPR GTTCCTGAACTTTCTATGGA GGG (reversed) Intergenic
No off target data available for this crispr