ID: 1171049187

View in Genome Browser
Species Human (GRCh38)
Location 20:21839743-21839765
Sequence GGTTCCTGAACTTTCTATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171049187_1171049192 15 Left 1171049187 20:21839743-21839765 CCTCCATAGAAAGTTCAGGAACC No data
Right 1171049192 20:21839781-21839803 TGGTGATAGACCTCAAAATGTGG No data
1171049187_1171049196 29 Left 1171049187 20:21839743-21839765 CCTCCATAGAAAGTTCAGGAACC No data
Right 1171049196 20:21839795-21839817 AAAATGTGGTTATTTCTGGGTGG No data
1171049187_1171049190 -5 Left 1171049187 20:21839743-21839765 CCTCCATAGAAAGTTCAGGAACC No data
Right 1171049190 20:21839761-21839783 GAACCGGCAACACTAATCTATGG No data
1171049187_1171049195 26 Left 1171049187 20:21839743-21839765 CCTCCATAGAAAGTTCAGGAACC No data
Right 1171049195 20:21839792-21839814 CTCAAAATGTGGTTATTTCTGGG No data
1171049187_1171049194 25 Left 1171049187 20:21839743-21839765 CCTCCATAGAAAGTTCAGGAACC No data
Right 1171049194 20:21839791-21839813 CCTCAAAATGTGGTTATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171049187 Original CRISPR GGTTCCTGAACTTTCTATGG AGG (reversed) Intergenic