ID: 1171049191

View in Genome Browser
Species Human (GRCh38)
Location 20:21839764-21839786
Sequence TCACCATAGATTAGTGTTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171049191_1171049194 4 Left 1171049191 20:21839764-21839786 CCGGCAACACTAATCTATGGTGA No data
Right 1171049194 20:21839791-21839813 CCTCAAAATGTGGTTATTTCTGG No data
1171049191_1171049197 15 Left 1171049191 20:21839764-21839786 CCGGCAACACTAATCTATGGTGA No data
Right 1171049197 20:21839802-21839824 GGTTATTTCTGGGTGGAAGTTGG No data
1171049191_1171049195 5 Left 1171049191 20:21839764-21839786 CCGGCAACACTAATCTATGGTGA No data
Right 1171049195 20:21839792-21839814 CTCAAAATGTGGTTATTTCTGGG No data
1171049191_1171049192 -6 Left 1171049191 20:21839764-21839786 CCGGCAACACTAATCTATGGTGA No data
Right 1171049192 20:21839781-21839803 TGGTGATAGACCTCAAAATGTGG No data
1171049191_1171049196 8 Left 1171049191 20:21839764-21839786 CCGGCAACACTAATCTATGGTGA No data
Right 1171049196 20:21839795-21839817 AAAATGTGGTTATTTCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171049191 Original CRISPR TCACCATAGATTAGTGTTGC CGG (reversed) Intergenic