ID: 1171049192

View in Genome Browser
Species Human (GRCh38)
Location 20:21839781-21839803
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171049183_1171049192 20 Left 1171049183 20:21839738-21839760 CCCTCCCTCCATAGAAAGTTCAG No data
Right 1171049192 20:21839781-21839803 TGGTGATAGACCTCAAAATGTGG No data
1171049187_1171049192 15 Left 1171049187 20:21839743-21839765 CCTCCATAGAAAGTTCAGGAACC No data
Right 1171049192 20:21839781-21839803 TGGTGATAGACCTCAAAATGTGG No data
1171049189_1171049192 12 Left 1171049189 20:21839746-21839768 CCATAGAAAGTTCAGGAACCGGC No data
Right 1171049192 20:21839781-21839803 TGGTGATAGACCTCAAAATGTGG No data
1171049186_1171049192 16 Left 1171049186 20:21839742-21839764 CCCTCCATAGAAAGTTCAGGAAC No data
Right 1171049192 20:21839781-21839803 TGGTGATAGACCTCAAAATGTGG No data
1171049184_1171049192 19 Left 1171049184 20:21839739-21839761 CCTCCCTCCATAGAAAGTTCAGG No data
Right 1171049192 20:21839781-21839803 TGGTGATAGACCTCAAAATGTGG No data
1171049191_1171049192 -6 Left 1171049191 20:21839764-21839786 CCGGCAACACTAATCTATGGTGA No data
Right 1171049192 20:21839781-21839803 TGGTGATAGACCTCAAAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171049192 Original CRISPR TGGTGATAGACCTCAAAATG TGG Intergenic
No off target data available for this crispr