ID: 1171049194

View in Genome Browser
Species Human (GRCh38)
Location 20:21839791-21839813
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171049186_1171049194 26 Left 1171049186 20:21839742-21839764 CCCTCCATAGAAAGTTCAGGAAC No data
Right 1171049194 20:21839791-21839813 CCTCAAAATGTGGTTATTTCTGG No data
1171049189_1171049194 22 Left 1171049189 20:21839746-21839768 CCATAGAAAGTTCAGGAACCGGC No data
Right 1171049194 20:21839791-21839813 CCTCAAAATGTGGTTATTTCTGG No data
1171049187_1171049194 25 Left 1171049187 20:21839743-21839765 CCTCCATAGAAAGTTCAGGAACC No data
Right 1171049194 20:21839791-21839813 CCTCAAAATGTGGTTATTTCTGG No data
1171049183_1171049194 30 Left 1171049183 20:21839738-21839760 CCCTCCCTCCATAGAAAGTTCAG No data
Right 1171049194 20:21839791-21839813 CCTCAAAATGTGGTTATTTCTGG No data
1171049184_1171049194 29 Left 1171049184 20:21839739-21839761 CCTCCCTCCATAGAAAGTTCAGG No data
Right 1171049194 20:21839791-21839813 CCTCAAAATGTGGTTATTTCTGG No data
1171049191_1171049194 4 Left 1171049191 20:21839764-21839786 CCGGCAACACTAATCTATGGTGA No data
Right 1171049194 20:21839791-21839813 CCTCAAAATGTGGTTATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171049194 Original CRISPR CCTCAAAATGTGGTTATTTC TGG Intergenic