ID: 1171049197

View in Genome Browser
Species Human (GRCh38)
Location 20:21839802-21839824
Sequence GGTTATTTCTGGGTGGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171049191_1171049197 15 Left 1171049191 20:21839764-21839786 CCGGCAACACTAATCTATGGTGA No data
Right 1171049197 20:21839802-21839824 GGTTATTTCTGGGTGGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171049197 Original CRISPR GGTTATTTCTGGGTGGAAGT TGG Intergenic