ID: 1171050573

View in Genome Browser
Species Human (GRCh38)
Location 20:21854395-21854417
Sequence GATGCTGGTGACCTACACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171050573_1171050577 7 Left 1171050573 20:21854395-21854417 CCCAAGTGTAGGTCACCAGCATC No data
Right 1171050577 20:21854425-21854447 AAAGGTAGATAAAGCCACAAAGG No data
1171050573_1171050579 11 Left 1171050573 20:21854395-21854417 CCCAAGTGTAGGTCACCAGCATC No data
Right 1171050579 20:21854429-21854451 GTAGATAAAGCCACAAAGGTGGG No data
1171050573_1171050580 12 Left 1171050573 20:21854395-21854417 CCCAAGTGTAGGTCACCAGCATC No data
Right 1171050580 20:21854430-21854452 TAGATAAAGCCACAAAGGTGGGG No data
1171050573_1171050578 10 Left 1171050573 20:21854395-21854417 CCCAAGTGTAGGTCACCAGCATC No data
Right 1171050578 20:21854428-21854450 GGTAGATAAAGCCACAAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171050573 Original CRISPR GATGCTGGTGACCTACACTT GGG (reversed) Intergenic
No off target data available for this crispr