ID: 1171057933

View in Genome Browser
Species Human (GRCh38)
Location 20:21926070-21926092
Sequence TGGTCTTATAGCTAGTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171057928_1171057933 14 Left 1171057928 20:21926033-21926055 CCTGAAGTCAGGAGGTCAGGCTA No data
Right 1171057933 20:21926070-21926092 TGGTCTTATAGCTAGTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171057933 Original CRISPR TGGTCTTATAGCTAGTGGGT GGG Intergenic
No off target data available for this crispr