ID: 1171058195

View in Genome Browser
Species Human (GRCh38)
Location 20:21928492-21928514
Sequence CAGTAGGCACAGATTTAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171058194_1171058195 -9 Left 1171058194 20:21928478-21928500 CCACTGGCTAGAGACAGTAGGCA No data
Right 1171058195 20:21928492-21928514 CAGTAGGCACAGATTTAATATGG No data
1171058192_1171058195 5 Left 1171058192 20:21928464-21928486 CCTGTGAATTATAGCCACTGGCT No data
Right 1171058195 20:21928492-21928514 CAGTAGGCACAGATTTAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171058195 Original CRISPR CAGTAGGCACAGATTTAATA TGG Intergenic
No off target data available for this crispr