ID: 1171058195 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:21928492-21928514 |
Sequence | CAGTAGGCACAGATTTAATA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1171058194_1171058195 | -9 | Left | 1171058194 | 20:21928478-21928500 | CCACTGGCTAGAGACAGTAGGCA | No data | ||
Right | 1171058195 | 20:21928492-21928514 | CAGTAGGCACAGATTTAATATGG | No data | ||||
1171058192_1171058195 | 5 | Left | 1171058192 | 20:21928464-21928486 | CCTGTGAATTATAGCCACTGGCT | No data | ||
Right | 1171058195 | 20:21928492-21928514 | CAGTAGGCACAGATTTAATATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1171058195 | Original CRISPR | CAGTAGGCACAGATTTAATA TGG | Intergenic | ||
No off target data available for this crispr |