ID: 1171062616

View in Genome Browser
Species Human (GRCh38)
Location 20:21981167-21981189
Sequence TTAATAAGAGGGGCTCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171062616_1171062631 27 Left 1171062616 20:21981167-21981189 CCTTGCAGAGCCCCTCTTATTAA No data
Right 1171062631 20:21981217-21981239 CCAGATCCTTTCCCTTTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171062616 Original CRISPR TTAATAAGAGGGGCTCTGCA AGG (reversed) Intergenic
No off target data available for this crispr