ID: 1171062631

View in Genome Browser
Species Human (GRCh38)
Location 20:21981217-21981239
Sequence CCAGATCCTTTCCCTTTCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171062625_1171062631 -10 Left 1171062625 20:21981204-21981226 CCCCCCTACTTTTCCAGATCCTT No data
Right 1171062631 20:21981217-21981239 CCAGATCCTTTCCCTTTCTAAGG No data
1171062621_1171062631 0 Left 1171062621 20:21981194-21981216 CCCTGCCCAACCCCCCTACTTTT No data
Right 1171062631 20:21981217-21981239 CCAGATCCTTTCCCTTTCTAAGG No data
1171062624_1171062631 -6 Left 1171062624 20:21981200-21981222 CCAACCCCCCTACTTTTCCAGAT No data
Right 1171062631 20:21981217-21981239 CCAGATCCTTTCCCTTTCTAAGG No data
1171062620_1171062631 1 Left 1171062620 20:21981193-21981215 CCCCTGCCCAACCCCCCTACTTT No data
Right 1171062631 20:21981217-21981239 CCAGATCCTTTCCCTTTCTAAGG No data
1171062619_1171062631 15 Left 1171062619 20:21981179-21981201 CCTCTTATTAATAACCCCTGCCC No data
Right 1171062631 20:21981217-21981239 CCAGATCCTTTCCCTTTCTAAGG No data
1171062617_1171062631 17 Left 1171062617 20:21981177-21981199 CCCCTCTTATTAATAACCCCTGC No data
Right 1171062631 20:21981217-21981239 CCAGATCCTTTCCCTTTCTAAGG No data
1171062622_1171062631 -1 Left 1171062622 20:21981195-21981217 CCTGCCCAACCCCCCTACTTTTC No data
Right 1171062631 20:21981217-21981239 CCAGATCCTTTCCCTTTCTAAGG No data
1171062616_1171062631 27 Left 1171062616 20:21981167-21981189 CCTTGCAGAGCCCCTCTTATTAA No data
Right 1171062631 20:21981217-21981239 CCAGATCCTTTCCCTTTCTAAGG No data
1171062618_1171062631 16 Left 1171062618 20:21981178-21981200 CCCTCTTATTAATAACCCCTGCC No data
Right 1171062631 20:21981217-21981239 CCAGATCCTTTCCCTTTCTAAGG No data
1171062623_1171062631 -5 Left 1171062623 20:21981199-21981221 CCCAACCCCCCTACTTTTCCAGA No data
Right 1171062631 20:21981217-21981239 CCAGATCCTTTCCCTTTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171062631 Original CRISPR CCAGATCCTTTCCCTTTCTA AGG Intergenic
No off target data available for this crispr