ID: 1171063865

View in Genome Browser
Species Human (GRCh38)
Location 20:21994073-21994095
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171063865_1171063868 -3 Left 1171063865 20:21994073-21994095 CCAGAAACTTGCTTCCTAACCTA No data
Right 1171063868 20:21994093-21994115 CTACAACTTAAAATAGTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171063865 Original CRISPR TAGGTTAGGAAGCAAGTTTC TGG (reversed) Intergenic
No off target data available for this crispr