ID: 1171070634

View in Genome Browser
Species Human (GRCh38)
Location 20:22065043-22065065
Sequence CAGTGGAAATAGTGGAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171070634_1171070645 23 Left 1171070634 20:22065043-22065065 CCATCTTTCCACTATTTCCACTG No data
Right 1171070645 20:22065089-22065111 TTTGTCATGGTTCACTGGTGGGG No data
1171070634_1171070642 18 Left 1171070634 20:22065043-22065065 CCATCTTTCCACTATTTCCACTG No data
Right 1171070642 20:22065084-22065106 TCATTTTTGTCATGGTTCACTGG No data
1171070634_1171070644 22 Left 1171070634 20:22065043-22065065 CCATCTTTCCACTATTTCCACTG No data
Right 1171070644 20:22065088-22065110 TTTTGTCATGGTTCACTGGTGGG No data
1171070634_1171070643 21 Left 1171070634 20:22065043-22065065 CCATCTTTCCACTATTTCCACTG No data
Right 1171070643 20:22065087-22065109 TTTTTGTCATGGTTCACTGGTGG No data
1171070634_1171070640 10 Left 1171070634 20:22065043-22065065 CCATCTTTCCACTATTTCCACTG No data
Right 1171070640 20:22065076-22065098 TCTTCCACTCATTTTTGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171070634 Original CRISPR CAGTGGAAATAGTGGAAAGA TGG (reversed) Intergenic
No off target data available for this crispr