ID: 1171077388

View in Genome Browser
Species Human (GRCh38)
Location 20:22142497-22142519
Sequence CTGAATAATAACCCTTGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171077385_1171077388 1 Left 1171077385 20:22142473-22142495 CCAAGAGCTCAAGTCCAAGAAGG No data
Right 1171077388 20:22142497-22142519 CTGAATAATAACCCTTGTGATGG No data
1171077384_1171077388 29 Left 1171077384 20:22142445-22142467 CCATAGAGGTCAGCTGTATCAGA No data
Right 1171077388 20:22142497-22142519 CTGAATAATAACCCTTGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171077388 Original CRISPR CTGAATAATAACCCTTGTGA TGG Intergenic
No off target data available for this crispr