ID: 1171079201

View in Genome Browser
Species Human (GRCh38)
Location 20:22160939-22160961
Sequence CTAAATCTTACATGATTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171079199_1171079201 -8 Left 1171079199 20:22160924-22160946 CCAGGTTTCGTGGGTCTAAATCT No data
Right 1171079201 20:22160939-22160961 CTAAATCTTACATGATTTGGAGG No data
1171079198_1171079201 -7 Left 1171079198 20:22160923-22160945 CCCAGGTTTCGTGGGTCTAAATC No data
Right 1171079201 20:22160939-22160961 CTAAATCTTACATGATTTGGAGG No data
1171079195_1171079201 9 Left 1171079195 20:22160907-22160929 CCGTATAAAAGGCAGACCCAGGT No data
Right 1171079201 20:22160939-22160961 CTAAATCTTACATGATTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171079201 Original CRISPR CTAAATCTTACATGATTTGG AGG Intergenic
No off target data available for this crispr