ID: 1171085229

View in Genome Browser
Species Human (GRCh38)
Location 20:22232575-22232597
Sequence CAGGCAATGAGTGCAGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171085221_1171085229 30 Left 1171085221 20:22232522-22232544 CCATAGCAAGTCGTGGAATGGAG No data
Right 1171085229 20:22232575-22232597 CAGGCAATGAGTGCAGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171085229 Original CRISPR CAGGCAATGAGTGCAGCTGC TGG Intergenic
No off target data available for this crispr