ID: 1171087050

View in Genome Browser
Species Human (GRCh38)
Location 20:22247209-22247231
Sequence CAACCACGGAGGTGCCAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171087050_1171087064 30 Left 1171087050 20:22247209-22247231 CCCCCTTGGCACCTCCGTGGTTG No data
Right 1171087064 20:22247262-22247284 GAACTTTCACACATCCCATGTGG No data
1171087050_1171087059 1 Left 1171087050 20:22247209-22247231 CCCCCTTGGCACCTCCGTGGTTG No data
Right 1171087059 20:22247233-22247255 CTTACACACCAGACCTGGCAGGG No data
1171087050_1171087060 2 Left 1171087050 20:22247209-22247231 CCCCCTTGGCACCTCCGTGGTTG No data
Right 1171087060 20:22247234-22247256 TTACACACCAGACCTGGCAGGGG No data
1171087050_1171087058 0 Left 1171087050 20:22247209-22247231 CCCCCTTGGCACCTCCGTGGTTG No data
Right 1171087058 20:22247232-22247254 GCTTACACACCAGACCTGGCAGG No data
1171087050_1171087061 5 Left 1171087050 20:22247209-22247231 CCCCCTTGGCACCTCCGTGGTTG No data
Right 1171087061 20:22247237-22247259 CACACCAGACCTGGCAGGGGTGG No data
1171087050_1171087057 -4 Left 1171087050 20:22247209-22247231 CCCCCTTGGCACCTCCGTGGTTG No data
Right 1171087057 20:22247228-22247250 GTTGGCTTACACACCAGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171087050 Original CRISPR CAACCACGGAGGTGCCAAGG GGG (reversed) Intergenic
No off target data available for this crispr