ID: 1171088992

View in Genome Browser
Species Human (GRCh38)
Location 20:22266589-22266611
Sequence GTGTTTTTTAGCAACCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171088992_1171088995 -3 Left 1171088992 20:22266589-22266611 CCTGGGTGGTTGCTAAAAAACAC No data
Right 1171088995 20:22266609-22266631 CACTCAAAGGCCAAGCATGGTGG No data
1171088992_1171088994 -6 Left 1171088992 20:22266589-22266611 CCTGGGTGGTTGCTAAAAAACAC No data
Right 1171088994 20:22266606-22266628 AAACACTCAAAGGCCAAGCATGG No data
1171088992_1171088999 28 Left 1171088992 20:22266589-22266611 CCTGGGTGGTTGCTAAAAAACAC No data
Right 1171088999 20:22266640-22266662 TGCAATCCCAGCAGTTTGGGAGG 0: 82
1: 9759
2: 318599
3: 272965
4: 209503
1171088992_1171088997 24 Left 1171088992 20:22266589-22266611 CCTGGGTGGTTGCTAAAAAACAC No data
Right 1171088997 20:22266636-22266658 TGACTGCAATCCCAGCAGTTTGG No data
1171088992_1171088998 25 Left 1171088992 20:22266589-22266611 CCTGGGTGGTTGCTAAAAAACAC No data
Right 1171088998 20:22266637-22266659 GACTGCAATCCCAGCAGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171088992 Original CRISPR GTGTTTTTTAGCAACCACCC AGG (reversed) Intergenic
No off target data available for this crispr