ID: 1171090449

View in Genome Browser
Species Human (GRCh38)
Location 20:22280607-22280629
Sequence CTGCTGTTGTTGTGGGAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171090449_1171090452 7 Left 1171090449 20:22280607-22280629 CCACTTTCCCACAACAACAGCAG No data
Right 1171090452 20:22280637-22280659 TTGCGCAGAGACCTTCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171090449 Original CRISPR CTGCTGTTGTTGTGGGAAAG TGG (reversed) Intergenic
No off target data available for this crispr