ID: 1171093127

View in Genome Browser
Species Human (GRCh38)
Location 20:22305024-22305046
Sequence ATGGAAAAGAAGAAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171093127_1171093135 14 Left 1171093127 20:22305024-22305046 CCTTCCTCTTTCTTCTTTTCCAT No data
Right 1171093135 20:22305061-22305083 TACATTTTTCACAGTAAGCATGG No data
1171093127_1171093136 30 Left 1171093127 20:22305024-22305046 CCTTCCTCTTTCTTCTTTTCCAT No data
Right 1171093136 20:22305077-22305099 AGCATGGCCAATGAGCCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171093127 Original CRISPR ATGGAAAAGAAGAAAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr