ID: 1171099454

View in Genome Browser
Species Human (GRCh38)
Location 20:22368875-22368897
Sequence CACCCATGCAGTAGAGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171099454_1171099465 10 Left 1171099454 20:22368875-22368897 CCCCCCACTCTACTGCATGGGTG No data
Right 1171099465 20:22368908-22368930 GGCTCCAAGAATAAAGGAAGTGG No data
1171099454_1171099467 19 Left 1171099454 20:22368875-22368897 CCCCCCACTCTACTGCATGGGTG No data
Right 1171099467 20:22368917-22368939 AATAAAGGAAGTGGTGCAGAAGG No data
1171099454_1171099468 24 Left 1171099454 20:22368875-22368897 CCCCCCACTCTACTGCATGGGTG No data
Right 1171099468 20:22368922-22368944 AGGAAGTGGTGCAGAAGGCTAGG No data
1171099454_1171099463 4 Left 1171099454 20:22368875-22368897 CCCCCCACTCTACTGCATGGGTG No data
Right 1171099463 20:22368902-22368924 TGAGCCGGCTCCAAGAATAAAGG No data
1171099454_1171099469 25 Left 1171099454 20:22368875-22368897 CCCCCCACTCTACTGCATGGGTG No data
Right 1171099469 20:22368923-22368945 GGAAGTGGTGCAGAAGGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171099454 Original CRISPR CACCCATGCAGTAGAGTGGG GGG (reversed) Intergenic
No off target data available for this crispr