ID: 1171100537

View in Genome Browser
Species Human (GRCh38)
Location 20:22379625-22379647
Sequence CTGGAGGATGAGAGGCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171100537_1171100542 -9 Left 1171100537 20:22379625-22379647 CCCCAGGGCCTCTCATCCTCCAG No data
Right 1171100542 20:22379639-22379661 ATCCTCCAGCAGGCTAGCCCAGG No data
1171100537_1171100545 4 Left 1171100537 20:22379625-22379647 CCCCAGGGCCTCTCATCCTCCAG No data
Right 1171100545 20:22379652-22379674 CTAGCCCAGGCAACTGCCCATGG No data
1171100537_1171100550 15 Left 1171100537 20:22379625-22379647 CCCCAGGGCCTCTCATCCTCCAG No data
Right 1171100550 20:22379663-22379685 AACTGCCCATGGCCCTGGCTGGG No data
1171100537_1171100549 14 Left 1171100537 20:22379625-22379647 CCCCAGGGCCTCTCATCCTCCAG No data
Right 1171100549 20:22379662-22379684 CAACTGCCCATGGCCCTGGCTGG No data
1171100537_1171100548 10 Left 1171100537 20:22379625-22379647 CCCCAGGGCCTCTCATCCTCCAG No data
Right 1171100548 20:22379658-22379680 CAGGCAACTGCCCATGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171100537 Original CRISPR CTGGAGGATGAGAGGCCCTG GGG (reversed) Intergenic
No off target data available for this crispr