ID: 1171108972

View in Genome Browser
Species Human (GRCh38)
Location 20:22463145-22463167
Sequence CCTGCTTTTCAGCCGGCATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171108964_1171108972 19 Left 1171108964 20:22463103-22463125 CCAGGACAGGCTTCCCGCATGCA No data
Right 1171108972 20:22463145-22463167 CCTGCTTTTCAGCCGGCATAGGG No data
1171108968_1171108972 5 Left 1171108968 20:22463117-22463139 CCGCATGCACAAGCTGGAGGCAT No data
Right 1171108972 20:22463145-22463167 CCTGCTTTTCAGCCGGCATAGGG No data
1171108967_1171108972 6 Left 1171108967 20:22463116-22463138 CCCGCATGCACAAGCTGGAGGCA No data
Right 1171108972 20:22463145-22463167 CCTGCTTTTCAGCCGGCATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171108972 Original CRISPR CCTGCTTTTCAGCCGGCATA GGG Intergenic
No off target data available for this crispr