ID: 1171112769

View in Genome Browser
Species Human (GRCh38)
Location 20:22499745-22499767
Sequence TTCTACAGGCAGATGGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171112764_1171112769 8 Left 1171112764 20:22499714-22499736 CCTCAGACTCTCTCGCTGGCATG No data
Right 1171112769 20:22499745-22499767 TTCTACAGGCAGATGGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171112769 Original CRISPR TTCTACAGGCAGATGGTGCT GGG Intergenic
No off target data available for this crispr