ID: 1171113208 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:22502704-22502726 |
Sequence | CACTCTAACCATAAGGAGTT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1171113205_1171113208 | 20 | Left | 1171113205 | 20:22502661-22502683 | CCATCGAGGTTGCAAAATTCTAA | No data | ||
Right | 1171113208 | 20:22502704-22502726 | CACTCTAACCATAAGGAGTTGGG | No data | ||||
1171113204_1171113208 | 30 | Left | 1171113204 | 20:22502651-22502673 | CCGGGGGGGTCCATCGAGGTTGC | No data | ||
Right | 1171113208 | 20:22502704-22502726 | CACTCTAACCATAAGGAGTTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1171113208 | Original CRISPR | CACTCTAACCATAAGGAGTT GGG | Intergenic | ||
No off target data available for this crispr |