ID: 1171113208

View in Genome Browser
Species Human (GRCh38)
Location 20:22502704-22502726
Sequence CACTCTAACCATAAGGAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171113205_1171113208 20 Left 1171113205 20:22502661-22502683 CCATCGAGGTTGCAAAATTCTAA No data
Right 1171113208 20:22502704-22502726 CACTCTAACCATAAGGAGTTGGG No data
1171113204_1171113208 30 Left 1171113204 20:22502651-22502673 CCGGGGGGGTCCATCGAGGTTGC No data
Right 1171113208 20:22502704-22502726 CACTCTAACCATAAGGAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171113208 Original CRISPR CACTCTAACCATAAGGAGTT GGG Intergenic
No off target data available for this crispr