ID: 1171113696

View in Genome Browser
Species Human (GRCh38)
Location 20:22506202-22506224
Sequence ACACCAAGATGTCCACCTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171113696_1171113700 12 Left 1171113696 20:22506202-22506224 CCGCCAGGTGGACATCTTGGTGT No data
Right 1171113700 20:22506237-22506259 ACAACTTCACTCCCTTTTCCTGG No data
1171113696_1171113701 21 Left 1171113696 20:22506202-22506224 CCGCCAGGTGGACATCTTGGTGT No data
Right 1171113701 20:22506246-22506268 CTCCCTTTTCCTGGACACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171113696 Original CRISPR ACACCAAGATGTCCACCTGG CGG (reversed) Intergenic