ID: 1171114595

View in Genome Browser
Species Human (GRCh38)
Location 20:22513705-22513727
Sequence CAAACTAGGAAACCCGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171114595_1171114600 8 Left 1171114595 20:22513705-22513727 CCTGGAACGGGTTTCCTAGTTTG No data
Right 1171114600 20:22513736-22513758 ACCTGTCTAGAAGCTTCTATTGG No data
1171114595_1171114602 9 Left 1171114595 20:22513705-22513727 CCTGGAACGGGTTTCCTAGTTTG No data
Right 1171114602 20:22513737-22513759 CCTGTCTAGAAGCTTCTATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171114595 Original CRISPR CAAACTAGGAAACCCGTTCC AGG (reversed) Intergenic
No off target data available for this crispr