ID: 1171116540

View in Genome Browser
Species Human (GRCh38)
Location 20:22529710-22529732
Sequence GTTGTGTGAAGCAGTTTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171116540_1171116544 13 Left 1171116540 20:22529710-22529732 CCACCTAAACTGCTTCACACAAC No data
Right 1171116544 20:22529746-22529768 GCCCTGTGTTCCCAGAGTCAGGG No data
1171116540_1171116543 12 Left 1171116540 20:22529710-22529732 CCACCTAAACTGCTTCACACAAC No data
Right 1171116543 20:22529745-22529767 TGCCCTGTGTTCCCAGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171116540 Original CRISPR GTTGTGTGAAGCAGTTTAGG TGG (reversed) Intergenic
No off target data available for this crispr