ID: 1171119691

View in Genome Browser
Species Human (GRCh38)
Location 20:22557799-22557821
Sequence CTTGGGAGGCACCATGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171119691_1171119696 25 Left 1171119691 20:22557799-22557821 CCAGGCACATGGTGCCTCCCAAG No data
Right 1171119696 20:22557847-22557869 TGCCAAGTGCTTCTTGGCCGAGG No data
1171119691_1171119695 19 Left 1171119691 20:22557799-22557821 CCAGGCACATGGTGCCTCCCAAG No data
Right 1171119695 20:22557841-22557863 TGTCAATGCCAAGTGCTTCTTGG No data
1171119691_1171119697 26 Left 1171119691 20:22557799-22557821 CCAGGCACATGGTGCCTCCCAAG No data
Right 1171119697 20:22557848-22557870 GCCAAGTGCTTCTTGGCCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171119691 Original CRISPR CTTGGGAGGCACCATGTGCC TGG (reversed) Intergenic
No off target data available for this crispr