ID: 1171119700

View in Genome Browser
Species Human (GRCh38)
Location 20:22557864-22557886
Sequence GCCATGGGGAACGGTACCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171119700_1171119709 7 Left 1171119700 20:22557864-22557886 CCGAGGGTACCGTTCCCCATGGC No data
Right 1171119709 20:22557894-22557916 GGGATGCCAGGTGAGACTAGAGG No data
1171119700_1171119715 24 Left 1171119700 20:22557864-22557886 CCGAGGGTACCGTTCCCCATGGC No data
Right 1171119715 20:22557911-22557933 TAGAGGAACCTAAGCCTGGGGGG No data
1171119700_1171119714 23 Left 1171119700 20:22557864-22557886 CCGAGGGTACCGTTCCCCATGGC No data
Right 1171119714 20:22557910-22557932 CTAGAGGAACCTAAGCCTGGGGG No data
1171119700_1171119712 21 Left 1171119700 20:22557864-22557886 CCGAGGGTACCGTTCCCCATGGC No data
Right 1171119712 20:22557908-22557930 GACTAGAGGAACCTAAGCCTGGG No data
1171119700_1171119713 22 Left 1171119700 20:22557864-22557886 CCGAGGGTACCGTTCCCCATGGC No data
Right 1171119713 20:22557909-22557931 ACTAGAGGAACCTAAGCCTGGGG No data
1171119700_1171119707 -5 Left 1171119700 20:22557864-22557886 CCGAGGGTACCGTTCCCCATGGC No data
Right 1171119707 20:22557882-22557904 ATGGCCACAGCAGGGATGCCAGG No data
1171119700_1171119711 20 Left 1171119700 20:22557864-22557886 CCGAGGGTACCGTTCCCCATGGC No data
Right 1171119711 20:22557907-22557929 AGACTAGAGGAACCTAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171119700 Original CRISPR GCCATGGGGAACGGTACCCT CGG (reversed) Intergenic