ID: 1171119705

View in Genome Browser
Species Human (GRCh38)
Location 20:22557879-22557901
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171119705_1171119709 -8 Left 1171119705 20:22557879-22557901 CCCATGGCCACAGCAGGGATGCC No data
Right 1171119709 20:22557894-22557916 GGGATGCCAGGTGAGACTAGAGG No data
1171119705_1171119715 9 Left 1171119705 20:22557879-22557901 CCCATGGCCACAGCAGGGATGCC No data
Right 1171119715 20:22557911-22557933 TAGAGGAACCTAAGCCTGGGGGG No data
1171119705_1171119719 23 Left 1171119705 20:22557879-22557901 CCCATGGCCACAGCAGGGATGCC No data
Right 1171119719 20:22557925-22557947 CCTGGGGGGTCCCCAAAGTCGGG No data
1171119705_1171119712 6 Left 1171119705 20:22557879-22557901 CCCATGGCCACAGCAGGGATGCC No data
Right 1171119712 20:22557908-22557930 GACTAGAGGAACCTAAGCCTGGG No data
1171119705_1171119711 5 Left 1171119705 20:22557879-22557901 CCCATGGCCACAGCAGGGATGCC No data
Right 1171119711 20:22557907-22557929 AGACTAGAGGAACCTAAGCCTGG No data
1171119705_1171119717 22 Left 1171119705 20:22557879-22557901 CCCATGGCCACAGCAGGGATGCC No data
Right 1171119717 20:22557924-22557946 GCCTGGGGGGTCCCCAAAGTCGG No data
1171119705_1171119713 7 Left 1171119705 20:22557879-22557901 CCCATGGCCACAGCAGGGATGCC No data
Right 1171119713 20:22557909-22557931 ACTAGAGGAACCTAAGCCTGGGG No data
1171119705_1171119714 8 Left 1171119705 20:22557879-22557901 CCCATGGCCACAGCAGGGATGCC No data
Right 1171119714 20:22557910-22557932 CTAGAGGAACCTAAGCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171119705 Original CRISPR GGCATCCCTGCTGTGGCCAT GGG (reversed) Intergenic
No off target data available for this crispr