ID: 1171119708

View in Genome Browser
Species Human (GRCh38)
Location 20:22557886-22557908
Sequence CTCACCTGGCATCCCTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171119708_1171119719 16 Left 1171119708 20:22557886-22557908 CCACAGCAGGGATGCCAGGTGAG No data
Right 1171119719 20:22557925-22557947 CCTGGGGGGTCCCCAAAGTCGGG No data
1171119708_1171119714 1 Left 1171119708 20:22557886-22557908 CCACAGCAGGGATGCCAGGTGAG No data
Right 1171119714 20:22557910-22557932 CTAGAGGAACCTAAGCCTGGGGG No data
1171119708_1171119712 -1 Left 1171119708 20:22557886-22557908 CCACAGCAGGGATGCCAGGTGAG No data
Right 1171119712 20:22557908-22557930 GACTAGAGGAACCTAAGCCTGGG No data
1171119708_1171119717 15 Left 1171119708 20:22557886-22557908 CCACAGCAGGGATGCCAGGTGAG No data
Right 1171119717 20:22557924-22557946 GCCTGGGGGGTCCCCAAAGTCGG No data
1171119708_1171119724 30 Left 1171119708 20:22557886-22557908 CCACAGCAGGGATGCCAGGTGAG No data
Right 1171119724 20:22557939-22557961 AAAGTCGGGTCCCCAAAGTCGGG No data
1171119708_1171119715 2 Left 1171119708 20:22557886-22557908 CCACAGCAGGGATGCCAGGTGAG No data
Right 1171119715 20:22557911-22557933 TAGAGGAACCTAAGCCTGGGGGG No data
1171119708_1171119723 29 Left 1171119708 20:22557886-22557908 CCACAGCAGGGATGCCAGGTGAG No data
Right 1171119723 20:22557938-22557960 CAAAGTCGGGTCCCCAAAGTCGG No data
1171119708_1171119711 -2 Left 1171119708 20:22557886-22557908 CCACAGCAGGGATGCCAGGTGAG No data
Right 1171119711 20:22557907-22557929 AGACTAGAGGAACCTAAGCCTGG No data
1171119708_1171119713 0 Left 1171119708 20:22557886-22557908 CCACAGCAGGGATGCCAGGTGAG No data
Right 1171119713 20:22557909-22557931 ACTAGAGGAACCTAAGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171119708 Original CRISPR CTCACCTGGCATCCCTGCTG TGG (reversed) Intergenic