ID: 1171119709

View in Genome Browser
Species Human (GRCh38)
Location 20:22557894-22557916
Sequence GGGATGCCAGGTGAGACTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171119701_1171119709 -2 Left 1171119701 20:22557873-22557895 CCGTTCCCCATGGCCACAGCAGG No data
Right 1171119709 20:22557894-22557916 GGGATGCCAGGTGAGACTAGAGG No data
1171119705_1171119709 -8 Left 1171119705 20:22557879-22557901 CCCATGGCCACAGCAGGGATGCC No data
Right 1171119709 20:22557894-22557916 GGGATGCCAGGTGAGACTAGAGG No data
1171119700_1171119709 7 Left 1171119700 20:22557864-22557886 CCGAGGGTACCGTTCCCCATGGC No data
Right 1171119709 20:22557894-22557916 GGGATGCCAGGTGAGACTAGAGG No data
1171119706_1171119709 -9 Left 1171119706 20:22557880-22557902 CCATGGCCACAGCAGGGATGCCA No data
Right 1171119709 20:22557894-22557916 GGGATGCCAGGTGAGACTAGAGG No data
1171119704_1171119709 -7 Left 1171119704 20:22557878-22557900 CCCCATGGCCACAGCAGGGATGC No data
Right 1171119709 20:22557894-22557916 GGGATGCCAGGTGAGACTAGAGG No data
1171119698_1171119709 22 Left 1171119698 20:22557849-22557871 CCAAGTGCTTCTTGGCCGAGGGT No data
Right 1171119709 20:22557894-22557916 GGGATGCCAGGTGAGACTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171119709 Original CRISPR GGGATGCCAGGTGAGACTAG AGG Intergenic