ID: 1171119710

View in Genome Browser
Species Human (GRCh38)
Location 20:22557900-22557922
Sequence TAGGTTCCTCTAGTCTCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171119710_1171119717 1 Left 1171119710 20:22557900-22557922 CCAGGTGAGACTAGAGGAACCTA No data
Right 1171119717 20:22557924-22557946 GCCTGGGGGGTCCCCAAAGTCGG No data
1171119710_1171119724 16 Left 1171119710 20:22557900-22557922 CCAGGTGAGACTAGAGGAACCTA No data
Right 1171119724 20:22557939-22557961 AAAGTCGGGTCCCCAAAGTCGGG No data
1171119710_1171119719 2 Left 1171119710 20:22557900-22557922 CCAGGTGAGACTAGAGGAACCTA No data
Right 1171119719 20:22557925-22557947 CCTGGGGGGTCCCCAAAGTCGGG No data
1171119710_1171119723 15 Left 1171119710 20:22557900-22557922 CCAGGTGAGACTAGAGGAACCTA No data
Right 1171119723 20:22557938-22557960 CAAAGTCGGGTCCCCAAAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171119710 Original CRISPR TAGGTTCCTCTAGTCTCACC TGG (reversed) Intergenic
No off target data available for this crispr