ID: 1171119723

View in Genome Browser
Species Human (GRCh38)
Location 20:22557938-22557960
Sequence CAAAGTCGGGTCCCCAAAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171119708_1171119723 29 Left 1171119708 20:22557886-22557908 CCACAGCAGGGATGCCAGGTGAG No data
Right 1171119723 20:22557938-22557960 CAAAGTCGGGTCCCCAAAGTCGG No data
1171119710_1171119723 15 Left 1171119710 20:22557900-22557922 CCAGGTGAGACTAGAGGAACCTA No data
Right 1171119723 20:22557938-22557960 CAAAGTCGGGTCCCCAAAGTCGG No data
1171119716_1171119723 -4 Left 1171119716 20:22557919-22557941 CCTAAGCCTGGGGGGTCCCCAAA No data
Right 1171119723 20:22557938-22557960 CAAAGTCGGGTCCCCAAAGTCGG No data
1171119718_1171119723 -10 Left 1171119718 20:22557925-22557947 CCTGGGGGGTCCCCAAAGTCGGG No data
Right 1171119723 20:22557938-22557960 CAAAGTCGGGTCCCCAAAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171119723 Original CRISPR CAAAGTCGGGTCCCCAAAGT CGG Intergenic