ID: 1171123624

View in Genome Browser
Species Human (GRCh38)
Location 20:22584584-22584606
Sequence CCGCGCGCTTCCCGCCGCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 116}

Found 18 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171123624_1171123634 -4 Left 1171123624 20:22584584-22584606 CCGAGGCGGCGGGAAGCGCGCGG 0: 1
1: 0
2: 0
3: 12
4: 116
Right 1171123634 20:22584603-22584625 GCGGCGCGGGGGCTAGTGGGGGG 0: 1
1: 0
2: 1
3: 23
4: 262
1171123624_1171123631 -7 Left 1171123624 20:22584584-22584606 CCGAGGCGGCGGGAAGCGCGCGG 0: 1
1: 0
2: 0
3: 12
4: 116
Right 1171123631 20:22584600-22584622 CGCGCGGCGCGGGGGCTAGTGGG 0: 1
1: 0
2: 0
3: 6
4: 85
1171123624_1171123642 14 Left 1171123624 20:22584584-22584606 CCGAGGCGGCGGGAAGCGCGCGG 0: 1
1: 0
2: 0
3: 12
4: 116
Right 1171123642 20:22584621-22584643 GGGGGGTGGGGAGGAGGAGGAGG 0: 2
1: 22
2: 271
3: 2632
4: 15800
1171123624_1171123630 -8 Left 1171123624 20:22584584-22584606 CCGAGGCGGCGGGAAGCGCGCGG 0: 1
1: 0
2: 0
3: 12
4: 116
Right 1171123630 20:22584599-22584621 GCGCGCGGCGCGGGGGCTAGTGG 0: 1
1: 0
2: 4
3: 25
4: 276
1171123624_1171123643 18 Left 1171123624 20:22584584-22584606 CCGAGGCGGCGGGAAGCGCGCGG 0: 1
1: 0
2: 0
3: 12
4: 116
Right 1171123643 20:22584625-22584647 GGTGGGGAGGAGGAGGAGGAAGG 0: 1
1: 19
2: 216
3: 1706
4: 7839
1171123624_1171123638 2 Left 1171123624 20:22584584-22584606 CCGAGGCGGCGGGAAGCGCGCGG 0: 1
1: 0
2: 0
3: 12
4: 116
Right 1171123638 20:22584609-22584631 CGGGGGCTAGTGGGGGGGTGGGG 0: 1
1: 0
2: 5
3: 134
4: 1697
1171123624_1171123640 8 Left 1171123624 20:22584584-22584606 CCGAGGCGGCGGGAAGCGCGCGG 0: 1
1: 0
2: 0
3: 12
4: 116
Right 1171123640 20:22584615-22584637 CTAGTGGGGGGGTGGGGAGGAGG 0: 1
1: 2
2: 32
3: 254
4: 2193
1171123624_1171123639 5 Left 1171123624 20:22584584-22584606 CCGAGGCGGCGGGAAGCGCGCGG 0: 1
1: 0
2: 0
3: 12
4: 116
Right 1171123639 20:22584612-22584634 GGGCTAGTGGGGGGGTGGGGAGG 0: 1
1: 1
2: 20
3: 319
4: 2399
1171123624_1171123646 27 Left 1171123624 20:22584584-22584606 CCGAGGCGGCGGGAAGCGCGCGG 0: 1
1: 0
2: 0
3: 12
4: 116
Right 1171123646 20:22584634-22584656 GAGGAGGAGGAAGGAGGAGGAGG 0: 53
1: 301
2: 923
3: 2892
4: 9332
1171123624_1171123637 1 Left 1171123624 20:22584584-22584606 CCGAGGCGGCGGGAAGCGCGCGG 0: 1
1: 0
2: 0
3: 12
4: 116
Right 1171123637 20:22584608-22584630 GCGGGGGCTAGTGGGGGGGTGGG 0: 1
1: 0
2: 3
3: 51
4: 653
1171123624_1171123632 -6 Left 1171123624 20:22584584-22584606 CCGAGGCGGCGGGAAGCGCGCGG 0: 1
1: 0
2: 0
3: 12
4: 116
Right 1171123632 20:22584601-22584623 GCGCGGCGCGGGGGCTAGTGGGG 0: 1
1: 0
2: 0
3: 13
4: 133
1171123624_1171123644 21 Left 1171123624 20:22584584-22584606 CCGAGGCGGCGGGAAGCGCGCGG 0: 1
1: 0
2: 0
3: 12
4: 116
Right 1171123644 20:22584628-22584650 GGGGAGGAGGAGGAGGAAGGAGG 0: 4
1: 82
2: 593
3: 2614
4: 9239
1171123624_1171123641 11 Left 1171123624 20:22584584-22584606 CCGAGGCGGCGGGAAGCGCGCGG 0: 1
1: 0
2: 0
3: 12
4: 116
Right 1171123641 20:22584618-22584640 GTGGGGGGGTGGGGAGGAGGAGG 0: 1
1: 18
2: 139
3: 1456
4: 10938
1171123624_1171123633 -5 Left 1171123624 20:22584584-22584606 CCGAGGCGGCGGGAAGCGCGCGG 0: 1
1: 0
2: 0
3: 12
4: 116
Right 1171123633 20:22584602-22584624 CGCGGCGCGGGGGCTAGTGGGGG 0: 1
1: 0
2: 2
3: 10
4: 172
1171123624_1171123635 -3 Left 1171123624 20:22584584-22584606 CCGAGGCGGCGGGAAGCGCGCGG 0: 1
1: 0
2: 0
3: 12
4: 116
Right 1171123635 20:22584604-22584626 CGGCGCGGGGGCTAGTGGGGGGG 0: 1
1: 0
2: 1
3: 23
4: 236
1171123624_1171123645 24 Left 1171123624 20:22584584-22584606 CCGAGGCGGCGGGAAGCGCGCGG 0: 1
1: 0
2: 0
3: 12
4: 116
Right 1171123645 20:22584631-22584653 GAGGAGGAGGAGGAAGGAGGAGG 0: 50
1: 287
2: 939
3: 2937
4: 9261
1171123624_1171123636 0 Left 1171123624 20:22584584-22584606 CCGAGGCGGCGGGAAGCGCGCGG 0: 1
1: 0
2: 0
3: 12
4: 116
Right 1171123636 20:22584607-22584629 CGCGGGGGCTAGTGGGGGGGTGG 0: 1
1: 0
2: 1
3: 24
4: 567
1171123624_1171123647 30 Left 1171123624 20:22584584-22584606 CCGAGGCGGCGGGAAGCGCGCGG 0: 1
1: 0
2: 0
3: 12
4: 116
Right 1171123647 20:22584637-22584659 GAGGAGGAAGGAGGAGGAGGAGG 0: 34
1: 287
2: 1225
3: 3784
4: 11489

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171123624 Original CRISPR CCGCGCGCTTCCCGCCGCCT CGG (reversed) Intronic
900284472 1:1892391-1892413 CCACGCGCTTCCCCCTACCTAGG + Intergenic
900513343 1:3070342-3070364 CCGCGCGCACCCCGCAGCCCCGG + Intronic
902072264 1:13749778-13749800 CCGCGCACTTTCTGCCGCCCAGG - Intronic
902585837 1:17438307-17438329 CCGCGCGCTTGCCCCCGCCGGGG + Exonic
904652304 1:32014446-32014468 CCTCTCGCTTCCCGCCCCCTCGG + Intronic
905174282 1:36126153-36126175 CCGCGCCCTGCCCGCCTCCCTGG - Intergenic
910374499 1:86553529-86553551 CCGCCTGCTTCCCGCCGCTCAGG + Intronic
915916864 1:159945647-159945669 CCGAGCGCCTCCCGTCGCCCTGG + Intergenic
922096006 1:222443309-222443331 CCCACCGCTTCCCGCCTCCTTGG + Intergenic
922201677 1:223408105-223408127 CCCCGTGCTTCCCCCCACCTCGG - Intergenic
922586379 1:226737468-226737490 TCCCGCGCTGCCCGCCGCCGCGG + Exonic
922731035 1:227948771-227948793 CTGAGCGCTTCCAGCTGCCTGGG - Intergenic
923678595 1:236100990-236101012 CCCCGCGCTTCCCACAGCCCTGG + Intergenic
1063458995 10:6203579-6203601 GCGCGCGCGTCCCTCCGTCTCGG - Intronic
1065019965 10:21495760-21495782 CCGCGCGCAACCCGCAGCCCTGG - Exonic
1070327270 10:75397032-75397054 CCGCGAGCGTCCCGGCGCCCAGG - Intergenic
1077492821 11:2870006-2870028 CCGCGCGCTCCCTCCCGCCTGGG + Intergenic
1080606694 11:33869840-33869862 CGGCGCGCTGCTCGCCGCCGAGG + Exonic
1083393296 11:62371322-62371344 CCGCGCGCTTGCCCCTGCCGGGG - Intronic
1083722022 11:64607913-64607935 CCGCGCGCCGCCCGCCCTCTGGG - Exonic
1083912919 11:65720517-65720539 CTGCGCGCTTCTCATCGCCTGGG - Intronic
1083920644 11:65780163-65780185 CAGCGCGCCGCCCGCCGCCAGGG + Exonic
1084636851 11:70398604-70398626 GCGCTCGCTCACCGCCGCCTGGG - Exonic
1091730394 12:2876666-2876688 CCGCACCCTGCCCGCGGCCTCGG - Intronic
1092564233 12:9648066-9648088 CCTCGCGCCTCCCGCCCCCCGGG + Intergenic
1094485987 12:30926536-30926558 CCGGGCGCGTCCTGCCGGCTGGG + Intronic
1099304363 12:80936845-80936867 CCCCGCGCCTTCCGCAGCCTGGG + Intronic
1101592931 12:106139314-106139336 CCGCGGGCCCTCCGCCGCCTCGG + Exonic
1103800435 12:123534000-123534022 GCGCCCGCTTTCCGCCGCCCGGG + Intergenic
1104942065 12:132399822-132399844 CCGCGGGCTCCCGGACGCCTGGG + Intergenic
1110573135 13:77027210-77027232 CCGCCCCCTTCCCGCCCCCTTGG - Intergenic
1112287081 13:98113675-98113697 CCTCGTGATTCCCCCCGCCTTGG + Intergenic
1119643811 14:76334450-76334472 CCTCGCGCTCACAGCCGCCTGGG + Intronic
1122947783 14:105021054-105021076 CCGCCAGCTTCCCGCCGCTGAGG + Exonic
1123036639 14:105474498-105474520 CCGCACCCTGCCCGCCGCCCCGG + Intronic
1128075904 15:64825405-64825427 CCTCGCGCTTCCCACCACCAAGG + Intronic
1128322659 15:66703883-66703905 CCGCGCGCCGACCTCCGCCTGGG + Exonic
1132607794 16:800773-800795 CCCCGCCCCTCCCGCCACCTGGG + Intergenic
1136110827 16:28062971-28062993 TCGCCCTCCTCCCGCCGCCTGGG - Intronic
1137426294 16:48384603-48384625 CTGCGCTCTTCCTGCCGCTTCGG - Intronic
1140096894 16:71883632-71883654 CCGCGGGCACCCCGCCTCCTCGG - Intronic
1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG + Exonic
1144585748 17:16486623-16486645 CCGCTCCCCTCCCGCCACCTCGG + Intronic
1147179439 17:38674876-38674898 AGGCGCCCTCCCCGCCGCCTGGG - Exonic
1148777953 17:50106081-50106103 CCGCCCGCTCCCCGCCGCTGTGG - Intronic
1151324307 17:73369408-73369430 CCTCCCGCTGCCCGCCGTCTTGG - Intronic
1151662325 17:75525534-75525556 CCCCGCGCTTCCCGGGGCCGCGG + Intronic
1161057574 19:2198374-2198396 CTGGGGGCTTCCCGCGGCCTTGG + Intronic
1161068931 19:2250987-2251009 CCGTGCCCTTCCCGCCGCCCAGG + Exonic
1161452537 19:4354461-4354483 CCGCCCGCTGCCCACCGACTGGG - Intronic
1161682685 19:5687807-5687829 CCGCGCGCGTGGCGCCGCCGCGG - Intronic
1162954347 19:14090112-14090134 CGGCGCGCGTCCAGCCGCCCCGG - Exonic
1164693807 19:30228737-30228759 CCGCGAGCTGCGCGCCGCCCCGG + Intronic
1165696799 19:37906984-37907006 CCGCGCTCTTCGCCCCGCCGGGG - Intergenic
1166044718 19:40223235-40223257 CGGCTCCCATCCCGCCGCCTCGG + Exonic
1166304230 19:41928536-41928558 CCGCGCGCCTCCCGCCCTCGCGG + Intronic
1166367411 19:42284486-42284508 CCGCCTGCCTCCCGCCGCCCGGG - Intronic
1166844362 19:45717721-45717743 CCGCCTGCTTCCTTCCGCCTTGG - Intronic
1167376300 19:49114218-49114240 CCGCGCCCTGCCCTCCGCCCCGG - Intergenic
925905234 2:8536191-8536213 CCACGTGCCTCCCGCCCCCTGGG - Intergenic
926190125 2:10721849-10721871 CCGCGCGCTTCCCCGCGGCCGGG + Intronic
927467870 2:23350685-23350707 CCGCCGGCTTCCCGCAGCTTCGG + Intergenic
927633429 2:24793645-24793667 CCGCGCCCATCCCGCGGCCCCGG - Intronic
930046289 2:47175959-47175981 GCGCGCTCCTCCCGCCCCCTGGG + Intronic
932036720 2:68252868-68252890 CCTCGCGCTTCCTCCCGCCGGGG - Intronic
933157673 2:78993197-78993219 CCGCGCCCTTCTCCGCGCCTCGG + Intergenic
934260973 2:91477361-91477383 CCCCCCGCCCCCCGCCGCCTCGG + Intergenic
941917718 2:170823258-170823280 CCGAGAGCCGCCCGCCGCCTGGG + Intronic
942453507 2:176122872-176122894 CGGCGCGCTTCGGGCCGCCGGGG + Exonic
944154080 2:196592997-196593019 CCGGGCGCTTCTCGCGGTCTCGG - Intronic
944221841 2:197310875-197310897 TCGCTCGCCGCCCGCCGCCTGGG + Intronic
946075912 2:217073393-217073415 CCGAGCGCTTCCTGGAGCCTGGG + Intergenic
947717967 2:232351343-232351365 CCGCGCGCATCCCGTAGCCCAGG - Intergenic
947765231 2:232633580-232633602 CCGCCGGGTCCCCGCCGCCTCGG + Exonic
948102313 2:235384775-235384797 CCCAGTGCTTCCCGCGGCCTGGG + Intergenic
948920581 2:241064239-241064261 CCGCCCTCTGCCCGCCGCCTTGG + Intronic
1171123624 20:22584584-22584606 CCGCGCGCTTCCCGCCGCCTCGG - Intronic
1174607009 20:51768396-51768418 CCGCGCCCCCCGCGCCGCCTGGG + Exonic
1180650026 22:17369725-17369747 CCGCGCTCTGCCCGCCGACCTGG - Exonic
1181006458 22:20016081-20016103 CCGCGCTGCTCCTGCCGCCTCGG - Intronic
1181024003 22:20117470-20117492 CGGCGCGTTTCCCGCCGCTGGGG + Intronic
1182321494 22:29480846-29480868 CAGCGCGCGGGCCGCCGCCTCGG - Exonic
1183546013 22:38455233-38455255 CCGCGCCCTCGGCGCCGCCTCGG + Intergenic
1183720112 22:39557707-39557729 CCCCGCGCTCCCCGCCGCGCTGG + Intergenic
1183747080 22:39698230-39698252 TCCCGCGCTTCCTGCAGCCTGGG - Intergenic
1184796950 22:46738229-46738251 CCGCCCGCCGCCCGCCGCCCGGG - Exonic
1185409213 22:50673854-50673876 CGGGGCCCTTCCCACCGCCTCGG - Intergenic
951558595 3:23945160-23945182 CCGCCCGCTTCCCGGCTCCCCGG - Intronic
954630981 3:52047488-52047510 CCGCGGGCTTCCCCAGGCCTGGG + Intergenic
961389152 3:126542182-126542204 GCGCGCGCTCCCCGACGCCCGGG + Exonic
967858184 3:194134094-194134116 CTCCGCCCTTCCCGCCGCCTGGG - Intergenic
968258380 3:197298661-197298683 CCCCGCCCTCCCCGCCCCCTGGG - Intronic
972312100 4:37891219-37891241 CTGCGCTCTTCCCGCCGCGGGGG - Exonic
976390107 4:84498003-84498025 CCGGGGGCTTCAGGCCGCCTGGG + Exonic
996208926 5:120780815-120780837 CCTCGCGATTCCCCCCGCCTCGG - Intergenic
1006472188 6:34235534-34235556 CCGAGCGCTTCCCGCCGCACGGG + Intergenic
1009909227 6:69904965-69904987 CTGCGTGCTTCCAGCTGCCTCGG + Intronic
1017163875 6:151390612-151390634 ACGCGCGCTTCCGGCCTCCTCGG - Intronic
1018635074 6:165854092-165854114 CCACGGGCTTCCCCCTGCCTGGG - Intronic
1019531256 7:1504504-1504526 CAGCCCGCCTCCCGCCGCCATGG - Intergenic
1020278439 7:6637878-6637900 CCGAGCGCCTCCCGCCCCCCAGG - Exonic
1023703134 7:42912032-42912054 CCGCGCGAGCCCCGCCGCCTCGG + Exonic
1025004705 7:55344799-55344821 CCGCGCTCTCCCCAGCGCCTGGG + Intergenic
1026471151 7:70694744-70694766 GCGCGCTCCTCCCGCCGCCCGGG + Intronic
1029551711 7:101240093-101240115 CCCCGCTCTTCCCCACGCCTGGG - Intronic
1029832911 7:103280020-103280042 CCGGCAGTTTCCCGCCGCCTAGG + Intergenic
1034440502 7:151083392-151083414 CCGCGCCCACCCCGCCGCCCAGG - Intronic
1036786759 8:11692892-11692914 GCGCTCGCCTCCAGCCGCCTGGG + Intronic
1037769176 8:21789016-21789038 CCCCGCGCCGCCAGCCGCCTGGG - Intronic
1038644332 8:29350291-29350313 CCTCGCGCGCCCAGCCGCCTCGG - Exonic
1039079458 8:33721351-33721373 CCCCGCGCTGCCTGCCTCCTGGG + Intergenic
1044819186 8:96144540-96144562 CGGTGCCTTTCCCGCCGCCTTGG - Exonic
1045037081 8:98184227-98184249 CTGCGGGCTTCCCACGGCCTGGG - Intergenic
1046871330 8:119208516-119208538 CCGTGTCCTTCCCGCCGCCCCGG + Exonic
1049238601 8:141525258-141525280 CCTCACCCTTCCCGCCGCCCCGG - Intergenic
1053358241 9:37465118-37465140 CTGCGCGCTCCCCGACGCCTTGG + Intronic
1053482317 9:38424567-38424589 CCGCGCGGTGCCCGCGGCCCGGG + Intergenic
1056572021 9:87824774-87824796 CCGCGCGCTTCGGCGCGCCTTGG + Intergenic
1058058631 9:100473512-100473534 CCCTGCGCTTCCCGCCGTCCAGG + Exonic
1058663091 9:107283685-107283707 CCGCGCGCATACCGTCTCCTCGG - Exonic
1060700733 9:125747319-125747341 CCGCGCGCTCCCCGCCCGCGCGG - Intergenic
1061670720 9:132186732-132186754 CCGCGGGCTTCGCTCCGCTTTGG - Intronic
1062022303 9:134325457-134325479 CCGCCCGCCGCCCGCCGTCTCGG - Intronic
1062022602 9:134326529-134326551 CCGCCGGCTCCCCGCCGCCCGGG + Intronic
1188141804 X:26559196-26559218 CCCCGCGCTGCCTGCCTCCTGGG - Intergenic
1193722507 X:85003765-85003787 CCGCCCTCCTCCAGCCGCCTTGG - Intergenic
1195625171 X:106999805-106999827 CCGCGCGCCCCCCGCAGCCCAGG + Intronic
1200087074 X:153612232-153612254 CCTCGTGATCCCCGCCGCCTTGG - Intergenic
1200961630 Y:9001343-9001365 CCGTGCGTTTCCCTCTGCCTAGG + Intergenic